[ report an error in this record ] Print this page

Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats
Citation
Tytgat B, Vrleyen E, Obbels D, Peeters K, De Wever A, D'hondt S, De Meyer T, van Criekinge W, Vyverman W, Willems A (2018): Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats&v=1.1 https://doi.org/10.15468/q8fzq9
Contact: Tytgat, Bjorn

Access data
Archived data
Availability: Creative Commons License This dataset is licensed under a Creative Commons Attribution 4.0 International License.

Description
Bacterial data (16S rRNA) from terrestrial and aquatic Microbial mats in continental Antarctic. more

Geographic coverage: soil samples and lake samples from East Antarctica.
Taxonomic coverage: Bacterial 16S amplicons (V1-V3 region).
Sampling methods: Two terrestrial and seven limnetic microbial mat samples were collected aseptically during different field campaigns in December/January 2003 (PQ1, TM2 and TM4) and in January 2007 (BB50, BB115, LA3, SK5, WO10 and SO6). All samples were kept frozen during transport and stored at 220uC.
Study extent: One sample (PQ1) was collected on Pourquoi-Pas Island off the west coast of Graham Land (Antarctic Peninsula). All other samples were collected from Eastern Antarctic habitats. The two terrestrial microbial mat samples (BB50 and BB115) were taken near the Utsteinen nunatak in the Sør Rondane Mountains (Dronning Maud Land). Three samples were from Lu ̈tzow-Holm Bay (Dronning Maud Land), namely from a small saline lake in Langhovde (LA3), from Naka-Tempyo Lake (SK5) in Skarvsnes, and from a small saline pond (WO10) in West Ongul Island. One sample (SO6) was taken from Lake Melkoye (unofficial name) in Schirmacher Oasis (Dronning Maud Land). The two remaining samples were collected in the Transantarctic Mountains. Sample TM2 was taken from Forlidas Pond (Dufek Massif, Pensacola Mountains), while sample TM4 was taken from Lundstro ̈m Lake (Shackleton Range).
Method step description:
1.DNA was extracted from frozen samples using 5 g per sample. Extracellular DNA was first removed as described by Corinaldesi et al. and DNA extraction was subsequently performed according to Zwart et al. Sequencing of the 16S rRNA V1–V3 regions was performed using forward primer pA (AGAGTTTGATCCTGGCTCAG 8–27) and reverse primer BKL1 (GTATTACCGCGGCTGCTGGCA 536– 516). Because it proved impossible to concatenate the comple- mentary reads due to insufficient overlap, the forward and reverse sequences were analyzed separately. The forward reads hence cover the complete V1 and V2 regions, whereas the reverse reads cover the V3 and part of the V2 region for the longest sequences.
2. Multiplexing was done with barcodes proposed by Parames- waran et al. Each PCR mixture contained 1–2 ml of template DNA, 2 ml of fusion primers and barcodes (10 mM), 2.5 ml dNTPs (10 mM), 1.5 ml of 10x buffer, 0.25 ml of 5 U/ml FastStart High Fidelity Polymerase (Roche) and was adjusted to a final volume of 25 ml with sterile HPLC-water. PCR cycling included 3 min at 94uC, followed by 35 cycles of 94uC for 30 s, 55uC for 60 s and 72uC for 90 s and finally 8 min at 72uC. PCR products were purified using a High Pure PCR Product Purification Kit (Roche).
3. Pyrosequencing was performed on a Roche 454 GS FLX Titanium machine at NXTGNT (Ghent, Belgium) after quality control of the DNA with a Qubit 2.0 Fluorometer (Life Technologies) and a Bioanalyzer (Agilent Technologies).

Scope
Themes:
Biology > Organic (& bio-) chemistry
Keywords:
Fresh water · Terrestrial · Antarctica · Lake · Metadata · Microbial mats · Rrna · Soil · Bacteria

Geographical coverage
Antarctica [Marine Regions]

Temporal coverage
1 January 2003 - 1 January 2007

Taxonomic coverage
Bacteria [WoRMS]

Parameter
Molecular data

Contributors
Universiteit Gent; Centrum voor Andrologie, moredata creator
Koninklijk Belgisch Instituut voor Natuurwetenschappen (IRScNB/KBIN), moredata creator

Related datasets
Published in:
AntOBIS: Antarctic Ocean Biodiversity Information System, more
(Partly) included in:
RAS: Register of Antarctic Species, more

Dataset status: Completed
Data type: Metadata
Data origin: Research: field survey
Metadatarecord created: 2018-12-04
Information last updated: 2019-04-10
All data in the Integrated Marine Information System (IMIS) is subject to the VLIZ privacy policy